Materials and Methods
Plant materials
Arabidopsis thaliana
ecotype Landsberg erecta was used for DNA and RNA isolation. Seeds, leaves,
flowers and stems were harvested from plants cultured in controlled environment
chambers at 21oC,
50% relative humidity, and constant light. Roots were obtained by culturing
sterilized seeds in Gamborg's B-5 medium (Gamborg et al.,
1968) in darkness at 25oC
for two weeks.
Isolation of cDNA clones
The cloning of FPG cDNAs from an A. thaliana flower cDNA library (Weigel et al, 1992) followed the techniques described previously (Murphy and Gao, 1998).
DNA gel blots
Total genomic DNA was isolated from the inflorescence
and leaves of A. thaliana ecotype Landsberg erecta by the CTAB (cetyltriethylammonium
bromide) extraction procedure (Ausubel et al, 1987)
with modifications. Lysis buffer (200 mM Tris, pH 7.5, 50 mM EDTA, 2 M NaCl,
52 mM CTAB), extraction buffer (349 mM D-sorbitol, 99 mM Tris, pH 7.5, 4.5 mM
EDTA, 15 mM Na-bisulfate) and 5% sarkosyl were mixed in proportions of 1:1:0.4
and heated to 65oC
to form a final extraction buffer. To this mixture the tissue, ground to a fine
powder in liquid nitrogen, was added and extracted over 30 min with two periods
of vortexing. After extraction with an equal volume of chloroform:1-octanol
(24:1) for 20 min, the aqueous phase was separated by centrifugation and nucleic
acids were precipitated with ethanol. The pellet was resuspended in TE buffer
(10 mM Tris-Cl, 1 mM EDTA, pH 7.5), RNAase was added to a final concentration
of 10 µg ml-1, and the solution was heated at 37oC
for 30 min to remove RNA. After one more extraction with chloroform:1-octanol
(24:1) and precipitation with ethanol, the purified DNA was dissolved in TE
buffer. DNA (7 µg) was digested with Eco R I, Hind III,
Xho 1 and Pst 1 restriction endonucleases, separated on a 0.8% agarose
gel, and transferred to Immobilon Ny+ nylon filters (Millipore Corporation,
Bedford, MA) as described by Sambrook et al. (1989).
Probes were synthesized by PCR. The 5'-terminal
probe (common to both Atfpg-1 and Atfpg-2: Figure
1A, probe 1) was the same one used for clone selection. Forward
and reverse primers for synthesizing clone-specific probes (Figure
1A, probes 2 and 3) were as follows (all 5' -> 3'): Atfpg-1,
AAGAAGACGATGGAGATGGGG and TGGGATAACTGTTAGCTGCCC; Atfpg-2,
ACCAAAACAGTATTCATTACC and GGTTTGAATCCCACATTTCAC.
All DNA fragments to be used as probes were purified by
0.8% agarose gel electrophoresis and labeled with [a32P]dCTP
(Random Primer DNA Labeling System, GIBCO BRL, Life Technologies, Gaithersburg,
MD). Hybridization was carried out in a solution of 6x SSC, 5x Denhardt's (Sambrook
et al., 1989), 0.5% SDS and 100 mg ml-1 herring sperm DNA for
22 h at 65oC.
Following hybridization, filters were washed twice for 10 min each with 2x SSC,
0.1% SDS at room temperature and thereafter twice for 20 min each at 65oC
and autoradiographed. After autoradiography the filters were stripped by boiling
in 0.1x SSC and 0.5% SDS to allow hybridization with a new probe. The same results
were obtained from three independent preparations.
RT-PCR
Total RNA isolated from seeds, leaves, roots, flowers
and stems as described above was analyzed by RT-PCR according to Gause and Adamovicz
(1995). RNA samples (15 µg) were treated at 25oC
for 1 h with 10 µg of RNAase-free DNAase in 30 µl of solution containing
100 mM Na acetate, pH 5.2, 10 mM MgCl2,
and 23.4 units of pancreatic RNAase inhibitor; the RNA was then purified by
chloroform extraction and ethanol precipitation. In separate reactions, cDNA
synthesis was performed using 3.6 µg of RNA from each organ and each clone-specific
Atfpg-1 or Atfpg-2 reverse primer described in the section on
DNA gel blots (Figure 1B, primers R1 and R2, respectively). The cDNA mixtures
were amplified by PCR using 5'-CTGCTTCTAGCCTCTTCAAAG-3' as forward primer (Figure
1B, primer F1) and the same reverse primers used for cDNA synthesis. cDNA synthesis
and PCR was performed at least twice for RNA samples from each organ. The products
were separated on 2% agarose gels, transferred to nylon filters, and hybridized
to clone-specific probes (Figure 1A, probes 2 and 3) as described for DNA gel
blots above. As a confirmation of the identity of RT-PCR products for Atfpg-2,
fragments extracted from an agarose gel were cloned using the Topo-TA procedure
of Invitrogen (La Jolla, CA), and the sequences of inserts of the appropriate
sizes were determined.